Dr. Miftahul Huda Fendiyanto, S.Si, M.Si.

Assessing Two Optimized Smart Automated Irrigation Systems for Four Chili Cultivars

Chili is one of the most important horticultural crops and a strategic national commodity. Efficient irrigation management is essential to sustain its productivity, particularly under increasing climate variability and water scarcity. This study evaluated the effects of two automated irrigation systems on the growth and yield of chili cultivars. The greenhouse experiment employed a split-plot design with two irrigation treatments—environmental sensor-based automatic irrigation (S1) and scheduled irrigation (S2)—on four chili cultivars (Arisa, Adelina, Genie, and Bara). Growth traits, including plant height, dichotomous height, number of leaves, number of branches, stem diameter, and SPAD, were observed weekly, while yield traits (fruit number, fresh weight, dry weight, average fruit weight, and fruit length) were measured at harvest. Results revealed no significant effect of interaction. Irrigation system affected number of branches, while varieties affected plant height, dichotomous height, SPAD and all yield traits except fruit number. The two irrigation systems did not statistically differ in yield, however, S1 consistently resulted in higher yield and save 61% water usage compared to S2. These findings indicate that S1 can enhance resource efficiency without compromising productivity, drought tolerant chili cultivars are recommended for supporting the sustainable cultivation of chili as a strategic commodity.

Intercorrelation among MOC1, MOC3, and TN1 Gene Expressions with the Architecture of Five Rice Genotypes

Tillering is an important rice characteristic that determines the architecture of the rice plant and affects yields. MONOCULM 1 protein encoded by the MOC1 gene interacts with MOC3 protein to influence axillary meristem formation and promote tillering. TILLER NUMBER 1 protein encoded by the TN1 gene to inhibit rice tillering. This study aimed to analyze the expression of tillering regulatory genes MOC1, MOC3, and TN1 in five rice genotypes based on their morphological characteristics. RNA was isolated at the pre tillering and tillering stages. Gene expression was analyzed using RT-PCR. The results showed that Hawara Bunar and Landeo rice produced fewer tillers (3-5) than IR64, Towuti, and Tukad Petanu (7-9). Although the number of tillers was lower, the grain weight produced by the Hawara Bunar rice cultivar was higher than that of the other four rice cultivars. The formation of a few tillers in Hawara Bunar and Landeo rice was influenced by low expression of the tiller regulatory genes MOC1 and MOC3 and by high expression of the TN1 gene, which inhibits tiller formation. These findings reveal a novel relationship between the expression of MOC1, MOC3, and TN1 genes and tiller formation, highlighting Hawara Bunar as a promising breeding line for rice with ideal plant architecture.

Rice QTL hotspots related with seed grain size, shape, weight, and color based on genome wide association study and linkage mapping

Rice is a staple crop worldwide, with seed traits such as size, shape, weight, and color playing crucial roles in agricultural productivity and consumer preferences. Despite significant progress, the genetic basis underlying the variation in hulled and unhulled seed grain traits remains partially unexplored. This study presents a comprehensive analysis combining GWAS and QTL mapping to dissect the genetic architecture of hulled and unhulled seed characteristics in rice. The aim is to identify quantitative trait loci (QTLs) associated with these traits using an integration of multi-model approach genome-wide association studies (GWAS) and linkage mapping analysis. The study analyzed 244 local rice varieties for GWAS and 90 Recombinant Inbred Lines for linkage mapping analysis. The traits observed included hulled and unhulled seed grain area, perimeter, length, width, length-to-width ratio, circularity, weight, and color (RGB, HSV, Lab, yCbCr). A total of 23 QTL regions were identified, with two major QTL hotspots located on chromosomes 7 and 2. Specifically, QTL hotspots on chromosome 7 were associated with grain size, shape, and weight, while those on chromosome 2 were linked to seed color. A total of 530 SNPs significantly associated with the traits were distributed across 12 rice chromosomes, corroborating the QTL hotspot regions. Six genes on chromosome 7 and seven genes on chromosome 2 were proposed as candidate genes regulating seed grain traits. These findings provide valuable insights into the genetic control of rice seed traits and offer potential targets for breeding programs aimed at improving rice quality and yield.

Genome-Wide SNP Discovery and Population Structure Analysis of 244 Indonesian Local Rice Accessions

Single Nucleotide Polymorphism (SNP) markers are essential tools for the genetic management and breeding of rice, enabling precise characterization of genetic diversity. However, SNP datasets specifically developed for analyzing the population structure of Indonesian local rice remain limited. This study aimed to identify polymorphic SNP markers and analyze the lineage and population structure of 244 Indonesian local rice accessions. BAM files of these accessions were obtained from the 3K Rice Genome Project via the International Rice Informatics Consortium. High-quality SNPs were generated through variant calling and stringent filtering, followed by annotation and population analyses using IR64, DJ123, and Nipponbare as references. A total of 3,839,961 high-quality SNP loci were identified across the 12 rice chromosomes. Hierarchical clustering and principal coordinate analysis consistently grouped the accessions into three major clusters, corresponding to Indica, Japonica, and admixed groups. Population structure analysis confirmed two main subpopulations: Indica and Japonica, with Japonica further divided into Temperate and Tropical subgroups. Eleven accessions showed admixed ancestry. This study provides essential insights into the genetic diversity and population structure of Indonesian local rice, supporting genetic resource conservation, trait discovery, and breeding efforts.

Identification Hierarchical Selection of Expressed Sequence Tags and their Expression under Drought Stress in Rice

The key components of drought-stress signaling that are responsible for drought tolerance in rice have not been identified yet. Although many expressed sequence tags (ESTs) of rice grown under drought stress have been identified and deposited in the GenBank, they have not been optimally used for functional analyzes. This research was thus established to analyze an EST dataset in order to understand the global gene expression profile induced by drought stress in rice, to discover novel droughttolerance genes using in silico study, and to confirm them through qRT-PCR analysis. A dataset of drought-response-related ESTs in rice was downloaded from the NCBI, preprocessed and grouped into clusters for functional analysis to obtain stressresponsive contigs. These contigs were then hierarchically selected to identify those related to transcription factors. The selected contigs were then incorporated into the drought-tolerant QTL on rice physical maps. The gene expression of each selected locus was evaluated in rice cv. Hawara Bunar and IR64 under drought stress. Gene Ontology analysis showed that the contigs consisted of genes encoding proteins involved in metabolic and cellular processes, related to catalytic and binding function, and located in the nucleus, cell membrane, and endomembrane organelles. Ten candidate genes potentially involved in regulating tolerance of drought stress were identified. They were located on rice chromosomes 1, 2, 3, 4, 6 and 9, and colocalized with the QTL for the drought-tolerance trait. Based on in silico and qRT-PCR analyzes, Os03g0160100, Os03g0815100, Os06g0601000 and Os09g0553100 were considered to be candidates for uncharacterized drought-responsive regulatory genes that potentially being used for manipulating drought tolerance in rice.

Metabolite profiling of some organs and the potential of Mukia javanica as an antihypertension

Mukia javanica is a close relative of the cucumber ( Cucumis sativus ) used to treat hypertension in the Leuwiliang community. Cucumis sativus contains calcium, magnesium, potassium, and phosphorus, which help lower blood pressure. In contrast, the content of metabolite compounds that are useful for lowering blood pressure in M. javanica has not been previously reported. Therefore, this research aimed to identify and determine the secondary metabolite content contained in several M. javanica organs and determine potential compounds that function in treating hypertension. The method used is the gas chromatography–mass spectrometry (GCMS) method. The samples analyzed included several organs of M. javanica , such as roots, stems, leaves, and fruit. Several organs are tested to determine the part of the plant with the most potential secondary metabolite compound content. Data analysis used the R version 3.5.2 program and the Metaboanalyst program. Based on the test results, 98 secondary metabolite compounds were identified and divided into several compound classes, and the most significant number of compounds identified was the terpenoid compound group. The 13-Tetradecen-1-acetate (root), Oleic acid (fruit), Phytol (stem), and 4-hydroxy-3-nitrocoumarin (root) content in Mukia javanica has the potential to be antihypertensive. Based on correlation analysis, the metabolites Hexadecanoic Acid Methyl Ester, Squalene, Vitamin E, and Stigmasta-7,16-Dien-3 show high correlation values. The compound Hexadecanoic Acid Methyl Ester is found in all parts, and it is reported to be associated with antihypertension and antioxidants. In the future, this compound has the potential to be used as a raw material for antihypertensive drugs.

Construction of a CRISPR/Cas9-mediated genome editing system in manipulating OsART1 from Oryza sativa cv. Inpago 5

Abstract. Fendiyanto MH, Setiawan E, Pratami MP, Kurniyanto IR, Fastanti FS. 2025. Construction of a CRISPR/Cas9-mediated genome editing system in manipulating OsART1 from Oryza sativa cv. Inpago 5. Biodiversitas 26: 920-927. Understanding the mechanism of aluminum (Al) tolerance in rice (Oryza sativa) cv. Inpago 5 can be done by mutating the ART1 gene to see which Al tolerance genes have decreased expression globally. This study aimed to construct a pRGEB32 vector containing sgRNA-ART1 derived from rice cv. Inpago 5. The construction of the pRGEB32-sgART1 vector was carried out by designing sgRNA, restriction-ligation, transformation, plasmid isolation, verification of target inserts, and sequencing of sgRNA-ART1. The results indicate that the construction of the recombinant vector pRGEB32-sgRNAART1 was carried out by combining digestion and ligase reactions. The construction of the recombinant pRGEB32 construction showed a high level of success in this study. The success of the ART1 sgRNA amplicon in recombinant Escherichia coli indicated this. Annotation studies showed that the pRGEB32 cassette plasmid sequence showed more than 99% homology with the recombinant pRGEB32-sgART1 sequence, especially only 1% was different, namely 20 bp of sgRNA that appeared different. After checking with alignment on the plasmid annotation using the MAAFT alignment method, it was found that 20 bp of ART1 sgRNA was successfully inserted into the pRGEB32-sgART1 recombinant vector. In conclusion, the construction of pRGEB32-sgART1 in this study was successful and showed the presence of a 425 bp band amplicon for the insertion from the region between M13 reverse and sgRNA-ART1.

CORRELATION ANALYSIS OF THE PLANT GROWTH, LEAF CHARACTERS, AND LIPID METABOLITE MARKERS IN JATROPHA CURCAS

E. SETIAWAN, M.P. PRATAMI, I.R. KURNIYANTO, and M.H. FENDIYANTO Citation: Setiawan E, Pratami MP, Kurniyanto IR, Fendiyanto MH (2025). Correlation analysis of the plant growth, leaf characters, and lipid metabolite markers in Jatropha curcas. SABRAO J. Breed. Genet. 57(5): 1862-1869. http://doi.org/10.54910/sabrao2025.57.5.8. Summary The physic nut (Jatropha curcas) plant, as a

Expression of TAD1 (Tillering & Dwarf1) Gene in Hawara Bunar and IR64 Rice Cultivars

Rice cv. Hawara Bunar is a local rice cultivar tolerant to aluminum (Al) and drought stress. However, the cultivar has inferior characteristics, such as a tall habitus and a small number of tillers, making the cultivar agronomically unattractive. Many genes control plant height and tiller number; one is the TAD1 gene. Analysis of gene expression in two contrasting rice cultivars for both characters is a prerequisite for selecting certain genes for gene editing targets. This study aimed to analyze the gene expression of the TAD1 in rice cv. IR64 and Hawara Bunar, and to construct a phylogenetic tree of genes that regulate rice plant height and tiller number. Gene expression analysis was conducted using the qRT-PCR technique, while the phylogenetic tree was constructed based on the Neighbor-Joining method using PAUP4 software. The results showed TAD1 gene expression in the tillering phase of rice cv. Hawara Bunar is higher than the cv. IR64. The gene expression level in both cultivars corresponds to the plant height and tiller number characters in both rice cultivars. Phylogenetic analysis showed that the TAD1 gene clustered with genes that cause the rice to have a tall habitus with few tillers. The results of a transcriptome meta-analysis reinforced the phylogenetic tree, which shows that the TAD1 gene was found in a group of downregulated genes based on the volcano plots. Therefore, the TAD1 gene can be selected as a target gene for editing in rice cv. Hawara Bunar to obtain superior characters.

Allelopathic Activity of Leaf and Root Extracts of Clidemia hirta to Morpho-Physiological Characters of Rice (Oryza sativa) and Some Weeds of Rice Field

The decline in worldwide rice production could be attributed to weed infestations. Weeds hinder the growth of rice plants, leading to reduced rice production. Conversely, the study and potency of extract of Clidemia hirta D.Don as bioherbicide in rice is limited. Based on these characteristics, Cl. hirta is suspected to have allelopathic potential as an herbicide to enhance rice production by inhibiting weed growth. Therefore, this research aimed to analyze the extract of the invasive alien species (IAS) plant Cl. hirta as an allelopathic agent in inhibiting weed growth in rice cultivation. The research methods include the identification and inventory of plant seeds, the preparation of leaf and root extracts of Cl. hirta in a water-based solvent, allelopathy extract tests on rice and weeds in the seedling and vegetative growth stages, morphological character analysis as a physiological response to the extract, and phytochemical tests. The tested weed species include Ageratum conyzoides, Echinochloa crus-galli, Cyperus iria and Ludwigia octovalvis, while the rice variety used is IR64 as a control. In summary, both leaf and root extracts of Cl. hirta inhibit the growth of A. conyzoides, E. crusgalli, Cy. iria and L. octovalvis. In contrast, rice growth was actually stimulated by the extract. Therefore, this study is expected to serve as a reference for the development of bioherbicides for rice cv. IR64.

Tools and Techniques Used at Global Scale Through Genomics, Transcriptomics, Proteomics, and Metabolomics to Investigate Plant Stress Responses at the Molecular Level

KARAKTERISTIK PERTUMBUHAN BIBIT BATANG BAWAH KARET YANG DIAPLIKASIKAN CENDAWAN DSE (DARK SEPTATE ENDOPHYTE)

Pembibitan batang bawah karet seringkali terkendala oleh adanya penyakit jamur akar putih (JAP), morfologi akar pendek dan kerdil. Salah satu upaya untuk menekan hal tersebut dilakukan dengan inokulasi cendawan DSE. Banyak penelitian menunjukkan respon pertumbuhan tanaman tahunan dan musiman meningkat setelah diaplikasikan DSE. Keragaman cendawan DSE lokal perakaran karet asal Sumatera Utara belum banyak dieksplorasi dan diketahui efektivitas dalam pertumbuhan tanaman. Penelitian ini bertujuan untuk mendapatkan informasi pengaruh DSE terhadap pertumbuhan dan fisiologi tanaman batang bawah karet. Rancangan percobaan menggunakan Rancangan Acak Lengkap (RAK) non faktorial dengan perlakuan aplikasi DSE isolat KHPSG, KLAJI, KRPPT dan kontrol (non isolat). Parameter pengamatan yaitu tinggi, diameter, panjang tangkai daun, jumlah daun, kadar IAA daun, gula total, dan total klorofil. Hasil penelitian diketahui bahwa DSE mempengaruhi karakter pertumbuhan tinggi, diameter batang, panjang tangkai daun, jumlah munculnya daun, kadar IAA daun, gula total dan total klorofil. Pengaruh DSE pada tanaman di pembibitan batang bawah polibeg diketahui terjadi saat fase awal pertumbuhan. Isolat KHPSG dan KLAJI merupakan isolat terbaik dan berpotensi dapat dijadikan sebagai stimulan hayati tanaman.

Genetic diversity of mangoes (Mangifera indica L.) and its relatives in Seliu Island, Belitung District, Indonesia based on Inter-Simple Sequence Repeat markers

Abstract. Resmi DDC, Chikmawati T, Djuita NR, Fendiyanto MH, Rahmawati D. 2024. Genetic diversity of mango (Mangifera indica L.) and its relatives in Seliu Island, Belitung District, Indonesia based on Inter-Simple Sequence Repeat markers. Biodiversitas 25: 4253-4264. Seliu Island is known as a mango island, but information on their identity, taxonomic status, and abundance of mango variety on this island has yet to be recorded. This study aimed to identify the genetic diversity of mangoes on Seliu Island. Fifteen Inter-Simple Sequence Repeat (ISSR) primers were used to profile the genetic diversity of 49 mango accessions from Seliu Island. The selected primers produced 193 polymorphic bands out of 222 (86.17%). All mango accessions on Seliu Island were identified and can be classified into eight species: Mangifera indica, Mangifera laurina, Mangifera zeylanica, Mangifera magnifica, Mangifera quadrifida, Mangifera caesia, Mangifera odorata, and Mangifera foetida. The genetic diversity among species was high, with a Shannon's information index of 0.334 and expected heterozygosity of 0.210. The unweighted pair group method with arithmetic average (UPGMA) dendrogram was created using a simple matching method, and all accessions were grouped into two main clusters according to their subgenus, Limus (Marchand) Kosterm and Mangifera. All accessions are also grouped according to their species. This study shows that the accessions from Seliu Island and West Java tend to cluster based on geographical origin. The study of mango genetic diversity using ISSR markers provided valuable information on the genetic relationships and variability among local mango cultivars on Seliu Island. This information can be used for breeding programs, conservation, and developing mango varieties.

Specific function of vitamin D in bone

There are two sources of vitamin D, namely from food and sun exposure. The content of vitamin D is given beneficial in bone and mineral metabolism. Vitamin D helps absorption of calcium in the intestines, thereby accelerating bone mineralization. Bone metabolism is a complex process that occurs throughout life. Very high doses of vitamin D can stimulate an increased rate of bone loss. Vitamin D deficiency causes bone demineralization. Which can cause a decrease in calcium absorption. The functions of these metabolites vary widely in vital metabolic pathways. This review aims to determine the specific function of vitamin D in bone. The search for the data base was carried out by the analytical method. Vitamin D which is absorbed from food or comes from the skin turns into an active form in the form of 1,25- (OH) 2-D3 which will enter the bloodstream, playing an important role in bone and extra-skeletal health.

Can Indonesia export vegetables? A feasibility study on the development of vegetables export to taiwan using a business partnership framework

Indonesia has various vegetable potentials that can be developed as export commodities. Taiwan is one of the countries with high potential as a destination for vegetable exports. AIM is a company that develop its business by exporting vegetables. In its activities, AIM faces challenges in maintaining the quality, quantity, and continuity of vegetable supplies for export. This research aimed to develop a sustainable business model for vegetable exports from Indonesia to Taiwan, focusing on a partnership framework then consider a feasibility study of the business model was carried out using two scenarios were evaluated: self-planting by AIM and partnering with local farmers. The results of the study showed that the business model by partnering with farmers is the best scenario with a higher feasibility value. The study revealed that the partnership model with farmers resulted in a 1.21 times higher income for AIM compared to the self-planting scenario. It reflected that the success of the business model that involves partnerships with farmers in increasing the quantity, quality, continuity of exported vegetable products. The partnership model not only enhances AIM’s profitability but also ensures the sustainability and competitiveness of Indonesian vegetable exports.

Metabolite comparative variation related lipid metabolisms among fruit, leaf, and stem of Jatropha curcas

The issue of non-renewable energy scarcity has persisted over an extended period, primarily due to the depletion of fossil fuel reserves and the adverse effects of their utilization. This scarcity stems from the finite nature of fossil energy resources. The development of oil energy or biofuels aims to utilize oil-producing plants such as Jatropha curcas to develop alternative energy resources. However, metabolomic studies in Jatropha curcas are limited and need more investigations. Therefore, this research was essential to find biomarkers of metabolites among the fruit, leaf, and stem of Jatropha curcas using the GC-MS technique. We tested the metabolite profile with the R program, especially the metaboanalystR package, to determine fold change metabolite and pathway analysis. We found that 54 metabolites were detected in both fruit, leaf, and stem tissues of Jatropha curcas L, of which 19 metabolites were upregulated in the fruit, 20 metabolites in the leaf, and 15 up-regulated metabolites in the stem. The metabolites found formed three clusters based on correlation and networking metabolites analysis. The three clusters showed a relationship with the lipid biosynthesis pathway. In this study, provisional information was obtained that there was a different pattern of expression of metabolites between fruit, leaf, and stem tissues in Jatropha curcas, which was thought to be related to the critical metabolites of oleic acid and methylcyclohexane carboxylate in the biosynthetic pathway of fatty acids and unsaturated fatty acids. This information is essential as an initial reference for genetic engineering Jatropha curcas so that it can be used to transform plants, especially lipid-producing plants, as a source of oil.

In-silico Gene Editing of LCYB in Musa acuminata and Its Functional Analysis Related to Lycopene Beta-Cyclase Pathway

Abstract Banana ( Musa acuminata ) has high biodiversity and belongs to the important commodities after rice, particularly in Indonesia. for effective biofortification of bananas, a thorough understanding of the fruit’s genetic makeup, nutritional composition, and bioavailability of nutrients is necessary. If the study of bananas is incomplete or lacking, it can impede the development of biofortified varieties. The gene-regulated vitamin A pathway in a banana is LCYB . Therefore, this study aimed to design activating LCYB gene using CRISPR/Cas 9 and predict its gene and protein functional analysis related to the lycopene beta-cyclase pathway. We performed sequence analysis of LCYB (GeneBank: KP406755.1) to construct sgRNA to activate the expression of LCYB by in-silico approaches. We also successfully amplified the LCYB gene in various accession collections. Based on in-silico predicting sgRNA activity, we found a total of 192 putative sgRNA both in the positive or negative strand in the M.acuminata LCYB gene sequence. We investigated three sgRNA targets sequence-related MaLCYB activation, i.e., CTTTAGATGAGTCATACAAGGGG, ACGAGAGTTCACTACCCAAGAGG, and AGAATTGAGTTGCTCCACCGAGG with an efficiency score of 73.23, 71.00, and 70.21%, respectively. The mutation of the gene could change the functional protein and influence the lycopene beta-cyclase pathway. In silico analysis was an important tool to predict genome editing in M.acuminata to minimize technical sgRNA construction in vivo.

A complete chloroplast and mitochondrial genome for velvet bean (Mucuna pruriens, Fabaceae), with genome structure and intergenomic sequence transfers analyses

Abstract Mucuna pruriens , commonly known as the velvet bean, holds considerable economic and cultural importance as a member of the Fabaceae family. The economic value of this plant is derived from its high protein content, medicinal properties, and potential applications in agriculture and industry. Although the entire nuclear genome consisting of 11 chromosomes of M. pruriens has been published, the comprehensive assembly of the organelle genome, specifically the mitochondria, has not been previously accomplished. The evaluation of sequence transfer from both the chloroplast and mitochondrial genomes to the nuclear genome has not been conducted. The complete chloroplast and mitochondrial genome of M. pruriens var. utilis was assembled and annotated through the utilization of a hybrid approach involving Illumina short-reads and Oxford Nanopore long-reads. The genome of chloroplasts was found to be arranged in a singular circular structure measuring 155,617 bp in length. This structure encompassed a total of 75 genes responsible for encoding proteins, along with 4 genes for ribosomal RNA and 28 genes for transfer RNA. The organization of the mitochondrial genome consisted of a singular circular structure measuring 410,745 bp in length, encompassing a total of 39 protein-coding genes, 4 ribosomal RNA genes, and 16 transfer RNA genes. Through the analysis of sequence transfer, it has been determined that a total of 154,498 bp and 158,285 bp of DNA, derived from the chloroplast and mitochondrial genome respectively, have been incorporated into the nuclear genome. These transfer events predominantly occurred in a relatively recent timeframe. The frequency of transfers of chloroplast to nuclear genome sequences was found to be similar to that of transfers of mitochondrial to nuclear genome sequences. This study presents the initial assembly of the entire organelle, specifically the mitochondrial genome of M. pruriens , which serves as a valuable tool for comprehending the genomic evolution within the diverse Fabaceae family.

Penyuluhan Penurunan Kasus Stunting untuk Meningkatkan Kualitas Generasi Muda di Desa Hambalang

This community service activity aims to provide knowledge and insight regarding improving the quality of the younger generation to reduce cases of stunting in Hambalang Village, Citeureup District, Bogor Regency. The stages in implementing community service activities start from the preparation stage, implementation stage, and evaluation stage. The method used in this community service activity is the lecture and question and answer method. Through this activity, it is hoped that the people of Hambalang Village, Citeureup District, Bogor Regency will have insight into improving the quality of the young generation to reduce stunting cases in Hambalang Village, Citeureup District, Bogor Regency.

LCYB GENE EXPRESSION AND MORPHOPHYSIOLOGICAL TRAITS OF MUSA ACUMINATA CULTIVARS

Banana (Musa acuminata) is a tropical fruit plant vigorously growing in Southeast Asia, particularly Indonesia. Despite its prevalence in different Musa acuminata cultivars, the LCYB gene expression and morphological and physiological traits remain unexplored. Therefore, the presented study sought to examine the manifestation of the LCYB gene and analyze various morphophysiological features. The promising research focused on probing the five cultivars of banana, specifically M. acuminata var. breviformis, M. acuminata var. tomentosa, M. acuminata var. malaccensis (Ridl.), M. acuminata var. microcarpa (Becc.), and M. acuminata var. rutilifers. The morphological observations revealed these cultivars have no prominent distinctions in stem size, fruit characteristics, banana blossom, and leaf traits. Remarkably, cultivar Rutilifers showed the highest carotenoid and total chlorophyll content levels. Inversely, the banana cultivars Breviformis and Microcarpa exhibited comparatively lower contents of physiological parameters than the other cultivars. Likewise, by analyzing the LCYB gene expression, it was evident that the cultivar Tomentosa displayed the superior level, followed by the cultivar Malaccensis. Conversely, the cultivar Microcarpa exhibited the lowest LCYB gene expression. To summarize the results, the applicable study enunciated a significant relationship between the LCYB gene expression and the chlorophyll and carotenoid contents across the various banana cultivars.

Integrating Differential Expression and Weighted Correlation Network Analysis for Identifying Genes Controlling Shoot Development in Sorghum Bicolor

Workshop Manajemen dan Substansi Pengelolaan Jurnal Ilmiah Menuju Jurnal Terakreditasi Nasional dan Internasional

Workshop on the management and substance of managing scientific journals towards national and international accredited journals aim to gain an understanding of how the management and substance of management of scientific journals towards national and international accredited journals within the Faculty of Military Mathematics and Natural Sciences, the Republic of Indonesia Defense University. The procedure for implementing activities starts from the preparation, implementation, and closing stages. This activity is very useful for improving the quality of scientific journal management at the Faculty of Military Mathematics and Natural Sciences, the Republic of Indonesia Defense University towards national and international accredited journals. This can also be seen from the response and enthusiasm of the participants who asked when carrying out management workshop activities and the substance of managing scientific journals towards this national and international accredited journal.

Construction of an ultra-high-density consensus genetic map and analysis of recombination rate variation in Sorghum bicolor

Abstract. Satrio RD, Nikmah IA, Fendiyanto MH, Pratami MP, Awwanah M, Sari NIP, Farah N, Nurhadiyanta. 2022. Construction of an ultra-high-density consensus genetic map and analysis of recombination rate variation in Sorghum bicolor. Asian J Agric 6: 47-54. Sorghum is one of the most widely grown cereal crops on a global scale. A consensus map is a method for combining genetic information from multiple populations, and it is an effective way to increase genome coverage and marker density. This study constructed a consensus map by combining publicly available marker data from four mapping populations. A total of 3449 non-redundant polymorphic markers at the nucleotide level were used to construct a single consensus map on 10 sorghum chromosomes. This study generated an ultra-high-density sorghum consensus map consisting of a large number of markers spanning 1571.68 cM and averaging one marker per 0.46 cM. Due to the high density of the markers, it is only 0.06% of the markers had an interval greater than 5 cM. The rates of local recombination were estimated using a set of all markers genetic and physical positions along each of the 10 chromosomes. The analysis of the recombination rate on 10 sorghum chromosomes revealed that it decreased as the centromere position was getting closer. The consensus map generated in this study can be used to integrate information related to sorghum genetic resources and QTLs to the genome sequence, thereby accelerating the discovery of novel potential genes in sorghum.

Mapping and identification of QTL for agro-physiological traits in rice (Oryza sativa L.) under drought stress

Analysis of Superoxide Dismutase (OsSOD) Gene Expression using qRT- PCR, its Morphophysiological Characters and Path Analysis in Rice Variety IR64 Under Aluminum Stress

Rice treated with aluminum (Al) can produce active oxygen species (AOS). The existence of AOS can cause the rice plants to become morpho-physiologically damaged and eventually cause a decrease in productivity. The AOS reductive compounds are physiologically responded by plants using antioxidant compounds, one of which is the superoxide dismutase enzyme (SOD). Therefore, this research aimed to analyze FeSOD, MnSOD and CuZnSOD gene expressions in IR64 rice variety as information for selection and genetic improvement of rice to overcome national food security. We tested the root architecture, analyzed SOD gene expression and performed path analysis tests. The results showed that rice treated with aluminum (Al) showed dramatically increased CuZnSOD and FeSOD gene expression, while MnSOD gene expression was relatively the same under Al stress or normal conditions. The level of expression of the two genes positively correlated with physiological characteristics such as chlorophyll and root length. Thus, these two genes can be used as markers in studying Al tolerance in Indica cv. rice. IR64.

Potential of invasive alien species Clidemia hirta as antibacterial against Salmonella typhi and Staphylococcus aureus

Abstract. Pratami MP, Fendiyanto MH, Satrio RD, Widana IDKK, Nikmah IA, Sari NIP, Awwanah M, Farah N, Darmadi D. 2021. Potential of invasive alien species Clidemia hirta as antibacterial against Salmonella typhi and Staphylococcus aureus. Biodiversitas 22: 3363-3369. Clidemia hirta D. Don is an invasive alien species (IAS) that is a threat to biodiversity in tropical country particularly Indonesia, and remains underutilized to date. Conversely, prevalence of typhus in Indonesia is generally higher every year. Thus, the aim of this study was to detect phytochemicals in ethanolic and aqueous extracts of C. hirta and their antibacterial activity against Salmonella typhi and Staphylococcus aureus. The research methods included sample identification, generating the simplicia, determination of water content, extraction, phytochemical screening tests, and antibacterial activity tests. Identification was made based on morphological characteristics. The water content in the dried powder of simplicia was 12.26 ± 0.39%. Phytochemical results showed that 70% ethanol extract of C. hirta contained flavonoids, saponins, tannins, and triterpenoids compounds. In addition, aqueous extract of C. hirta showed positive results on flavonoids, saponins, tannins, and steroids tests. Antibacterial activity results showed that ethanolic extracts of C. hirta inhibited S. typhi and S. aureus at all concentrations, while aqueous extract inhibited bacterial growth in only 12.5% ??and 25% concentrations. These findings indicate that C. hirta has antibacterial activity that inhibits S. typhi and S. aureus. This information can be used for adding preliminary data to metabolite interest researchers, i.e., biologists and biotechnologists in the future.

Differential hierarchical metabolites expression of red/white Salacca sumatrana arillus and its molecular docking studies

Abstract. Fendiyanto MH, Satrio RD, Widana IDKK, Pratami MP, Nikmah IA, Darmadi D. 2021. Differential hierarchical metabolites expression of red/white Salacca sumatrana Arillus and its molecular docking studies. Biodiversitas 22: 1014-1024. Salak Sidempuan (Salacca sumatrana) is one of the medicinal plants originating from tropical countries. However, there is very little research on the study of finding bioactive compounds in S. sumatrana using the metabolomic approach. Here, we use two population types of S. sumatrana, e.g., fruit with red and white arillus. We extracted the compounds from the two tissues using the GC-MS technique and further analyzed their antiviral potential using an in-silico molecular docking technique. Fold change analysis showed that in white arillus there were 21 upregulated compounds and 25 downregulated compounds. Metabolites that have high expression in white arillus tissue are ranxinic acid, nicotinic alcohol, stearic acid, 2-furan carboxaldehyde, and others. Six accessions from S. sumatrana based on PCA analysis and separate dendrogram according to the type of arillus, i.e., red and white arillus. Two compounds that act as antivirals found in this study are stearic acid and palmitic acid based on preliminary molecular docking studies. These two compounds could be used for further studies as a preventive measure against SARS-Cov-2 in the future, however, it needs further comprehensive and clinical analysis the future. In conclusion, metabolites in white arillus were distinctly different from red arillus of Snake fruits. In addition, studies on differential metabolite expression on two types of arillus (red/white) can be used as markers in identifying arillus color early by plant breeders.

Short Communication: Identification of spoilage fungi in Myristica fragrans using DG18 and CYA Media

Abstract. Fendiyanto MH, Satrio RD, Pratami MP, Nikmah IA. 2021. Short Communication: Identification of spoilage fungi in Myristica fragrans using DG18 and CYA Media. Asian J Trop Biotechnol 18: 51-54. To date, very few studies have been conducted on the identification of spoilage fungi in Myristica fragrans. Therefore, this study aimed to identify the spoilage fungi in Myristica fragrans growing on DG18 media and CYA Identification Media. Isolation of the fungus was carried out by the dilution plating method using a dilution range of 10-1 to 10-5. The isolation results at 10-2 and 10-3 dilutions on nutmeg (Myristica fragrans) seed samples indicated the presence of Aspergillus niger and A. flavus. The fungal species that could be found and identified using the direct plating method were A. niger, A. flavus, Penicillium citrinum, and Fusarium sp. The results of fungal isolation showed that the species of spoilage fungi on postharvest of M. fragrans seeds, including Aspergillus flavus, A. niger, A. tamarii, Endomyces fibuliger, Eurotium chevalieri, E. repens, and Penicillium citrinum, Trichoderma sp. The highest population of spoilage fungi isolated from Myristica fragrans seeds was Aspergillus niger. This finding indicates that A.niger can be identified as spoilage fungi isolated from Myristica fragrans.

Genome-wide SNP discovery, linkage mapping, and analysis of QTL for morpho-physiological traits in rice during vegetative stage under drought stress

The Preparedness of Communities around Cilacap Industrial Companies in facing Tsunami Treats

Some vital industries in Cilacap Regency such as PT Pertamina (Persero) Refinery Unit IV Cilacap, PT Solusi Bangun Indonesia Tbk Cilacap Factory, PT Dharmapala Usaha Sukses Cilacap and PT Pupuk Sriwidjaja Palembang Fertilizer Empowerment Unit Cilacap are located close to the southern coast of Java that has the potential to be exposed to the tsunami. If the industrial company is affected by the tsunami, it can create a cascading effect and can have a direct impact on the surrounding community. The cascading effects are technological failure, explosion, fire, the release of hazardous substances to the spread of chemicals that can endanger the environment and society. The purpose of this study is to analyze the preparedness of the communities surrounding the industrial companies in facing the tsunami threat and its subsequent dangers. This study uses a descriptive qualitative research method by using a case study approach by conducting interviews with key informants related to the field of prevention, preparedness and work safety in each company and officials of the Local Government of Cilacap Regency. Data collection was also carried out using a questionnaire method filled out by people around the industrial companies. The results showed that the average value of the preparedness index of the community around industrial companies in Cilacap was 71.70 which was included in the “Ready” category.

Genomic Improvement of Rice for Drought, Aluminum, and Iron Toxicity Stress Tolerance

OsGERLP: A novel aluminum tolerance rice gene isolated from a local cultivar in Indonesia

There is a decrease in the land available for rice cultivation due to the rapid conversion to urban uses. Subsequently, acid soil could be an alternative land cultivating rice, but will require the use of aluminum (Al)-tolerant rice varieties. This Al tolerance trait is genetically controlled, and there is a need to discover more genes needed to develop Al-tolerant rice. Therefore, the objective of this study was to clone and characterize a novel Al tolerance gene isolated from a local cultivar of Indonesian rice. The gene cloning was conducted based on the rye/rice microsynteny relationship. In addition, the root growth and gene expression analyses were performed to verify the role of the gene on Al tolerance in gene-silenced rice and in overexpressed transgenic tobacco. The results showed an Al tolerance candidate gene, OsGERLP, was successfully cloned from rice cv. Hawara Bunar, with its gene encoding a protein similar to a bacterial ribosomal L32 protein. Additionally, the analysis showed that low gene expression caused the gene-silenced rice to be sensitive to Al, while high expression induced the Al tolerance in transgenic tobacco. Furthermore, it was discovered that the gene expression level in both plants was in line with the lower expression of the OsFRDL4 gene in the silenced rice and the high expression of the MATE gene in transgenic tobacco also with the higher citrate secretion from transgenic tobacco roots. In conclusion, the OsGERLP gene could act as a regulator for other Al tolerance genes, with the potential to develop Al-tolerant rice varieties.

sgRNA design for DLT gene editing using CRISPR-Cas9 and in-silico mutation prediction in Rice cv. Hawara Bunar

Abstract The DWARF AND LOW TILLERRING ( DLT ) gene is a transcription factor for a gene involved in Brassinosteroid (BR) biosynthesis. Manipulating BR biosynthesis will affect the height and tiller number of rice. CRISPR-Cas9 is an accurate tool to edit a gene sequence. The accuracy of site editing of the CRISPR-Cas9-mediated target gene editing is determined by the 20 nucleotide sequences in the sgRNA and the binding site known as the Protospacer Adjacent Motif (PAM). The study aimed to design sgRNA and predict the DLT gene mutation sites in rice cv. Hawara Bunar. The exon 1 of the DLT gene was amplified using a primer pair designed from the reference gene. The PCR product was then sequenced, and the sequence was used to design sgRNA. The study has designed sgRNA located on the targeted sequence that corresponds to the Gras family protein domain of the exon1 DLT gene. The mutation sites were predicted to be at the domain site through the alignment of the nucleotide and amino acid sequences of the DLT gene and the reference gene. It is predicted that mutations in the target site that corresponds to the protein domain will change the protein structure and its function.

Identification, aflatoxin content, and antagonistic test of spoilage fungi in bread to Aspergillus niger

Abstract. Fendiyanto MH, Satrio RD. 2020. Identification, aflatoxin content, and antagonistic test of spoilage fungi in bread to Aspergillus niger. Bioteknologi 17: 60-66. The major problem in shelf storage life in bread is contamination by molds, fungi and mycotoxins. The growth of spoilage fungi indicates that the bread has structural damage. Infection from this fungus will affect the shelf life of the bread to be shorter. Contaminated bread may influenced human health in the future. One of the many solutions to overcome the fungi-contamination of bread is the use of biological agents. Aspergillus niger has the ability, as a biological agent, to suppress food-destroying pathogens in many foods, including bread. However, there are few reports about the antagonistic test in bread, particularly between A.niger as biological control agent to spoilage fungi. Therefore, this study aimed to analyze the growth antagonistic test of A. niger against food spoilage fungi, expecting the storage life of bread could be extended and mycotoxin contamination avoided. The antagonistic test was in the form of a test that utilizes the properties of microorganisms that grow faster than pathogens or produce antibiotic compounds. The methods used in this study included isolation and identification of fungi, water content analysis, aflatoxin test, and antagonistic test. Interestingly, the antagonist test results showed A. niger can inhibit the growth of spoilage fungi on bread. In conclusion, the species of fungus with the highest inhibition value was Hyphopichia burtonii, while the lowest was Saccharomyces cerevisiae. These findings indicate that A.niger can be used as a biological control in extending bread shelf storage in the future.

Metabolic profiling and pathway analysis in red arillus of Salacca sumatrana demonstrate significant pyruvate, sulfur, and fatty acid metabolisms

Abstract. Fendiyanto MH, Satrio RD, Darmadi D. 2020. Metabolic profiling and pathway analysis in red arillus of Salacca sumatrana demonstrate significant pyruvate, sulfur, and fatty acid metabolisms. Biodiversitas 21: 4361-4368. Salak or snake fruit (Salacca Reinw.; Arecaceae) is a tropical fruit that has high biodiversity in a tropical country such as Indonesia. Several types of salak can be found in Indonesia, one of which is Salacca sumatrana (Becc.) Mogea. Research on profiling metabolites in S. sumatrana has not been conducted. Therefore, the aim of this study was to determine the metabolite profile and pathway analysis in S. sumatrana, especially in red arillus tissue. This research was conducted by the method of gas chromatography-mass spectrometry (GC-MS) and the study of bioinformatics through metabolomics approaches. The results showed that red arillus had metabolites consisting of groups of fatty acids, esters, alcohols, xylene, phenols, etc.. Significant metabolites found were isobutyl acetate, palmitic acid, formic acid, 2-pentanoic acid, ethylic acid, n-hexadecoic acid, hydroxypentanoic acid, etc. There was a tendency that metabolite ethylic acid, identified as C00033 accession, was a key metabolite in either the pyruvate metabolism pathway or sulfur metabolisms with relatively high impact values. Pathway analysis using bioinformatics studies using MetaboAnalyst shows that four of ten pathways detected had a high log-ratio (p)/pathway impact, i.e., pyruvate metabolism, sulfur metabolism, fatty acid biosynthesis, and biosynthesis of unsaturated fatty acids. Thus, pyruvate, sulfur, and fatty acid metabolisms are important pathways in the red arillus of S. sumatrana. This study can be used as a reference in early metabolomic studies on S. sumatrana using GC-MS and the metabolites identified as metabolite markers can be used for plant breeding and biologists to understand the metabolic mechanism of the red arillus tissues from S. sumatrana.

QTL for aluminum tolerance on rice chromosome 3 based on root length characters.

PENGGUNAAN SENYAWA OSMOLIT DAN ALKALIN PADA PENYADAPAN TANAMAN KARET (Hevea brasiliensis)

Stimulants are one of the common ways to increase yield in rubber plants. Recent, the stimulant that is widely used in rubber tapping is ethephon. Ethephon material can prolong the flow of latex so that yield increases. The combination of osmolyte and alkaline compounds is expected to be an alternative stimulant. Therefore, this study aimed to examine the use of osmolytes and alkaline in rubber plants. This research was conducted at the Experimental Design of the Sungei Putih Estate Research, Deli Serdang, North Sumatra in May-September 2016 with PB 260 clones planting year 2010 with a tapping system S/2 D3 Ga1.0 6 / y (m) in panel B0-2. The experimental design used was a Randomized Complete Block Design (RCBD) with 28 combinations of treatments. The observation parameters in this study were yield (g/p/s), girth (cm) before treatment application and yield (g/p/s) and yield (kg/ha/year) after treatment application. The observations showed that the addition of stimulants with osmolyte and alkaline compounds had a significant effect yield on rubber (g/p/s) in the first tapping slices. The 5% osmolyte and 10% alkaline compounds have yield rubber which is comparable to the application of stimulants made from ethephon in the first tapping slices. Application of 5% osmolyte and 10% alkaline compounds can be used as an alternative stimulant in rubber plants.

Identification of drought-responsive regulatory genes by hierarchical selection of expressed sequence tags and their expression under drought stress in rice.

Correlation among Snpb11 markers, root growth, and physiological characters of upland rice under aluminum stress

Abstract. Fendiyanto MH, Satrio RD, Suharsono, Tjahjoleksono A, Miftahudin. 2019. Correlation among Snpb11 markers, root growth, and physiological characters of upland rice under aluminum stress. Biodiversitas 20: 1243-1254. The cultivation of upland rice in acid soils faces aluminum (Al) toxicity. Development of Al-tolerant rice could be one of the solutions to overcome the problem. Marker-assisted breeding to develop Al-tolerant rice requires at least a molecular marker for foreground selection. Snpb11 is a molecular marker developed from the nucleotide differences in a specific allele between Al-tolerant and sensitive rice. Snpb11 has never been used as a molecular marker in rice. Therefore this study aimed to examine the correlation among Snpb11 marker, root growth, and physiological characters under Al stress in upland rice. We used physiological characters and the Snpb11 marker to justify the Al tolerance level in several upland rice varieties. We found that physiological characters, i.e.: primary root length, total root length, chlorophyll, and carotenoid content showed positive correlation to Snpb11. Conversely, root malondialdehyde content, which represents the level of lipid peroxidation showed a negative correlation to Snpb11. There is evidence that the Snpb11 highly correlated with primary and total root length characters, which are the Al tolerance parameters used in rice. Therefore, Snpb11 markers can be used to distinguish the Al tolerance level in upland rice.